EST details — SGN-E393214

Search information 
Request: 393214Match: SGN-E393214
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182081Clone name: TUS-38-K7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182081 is on microarray TOM1 spot ID 1-1-2.3.10.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5203 [cLEC-30-O13] Trace: SGN-T29041 EST: SGN-E207045 Direction: 5' Facility: TIGR
Clone: SGN-C182081 [TUS-38-K7] Trace: SGN-T194539 EST: SGN-E393213 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393214Length: 574 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393214 [] (trimmed) AGAACTTCCACACCTACTCCATCATTTGGAAACCCCAACACATCATATTTTTGGTGGACAACACACCAATAAGAGTATACAAAAATGCTGAATCA
GTTGGTGTACCATTTCCAAAGAATCAGCCCATGAGGATTTACTCAAGCCTTTGGAATGCTGATGATTGGGCCACAAGAGGAGGCCTAGTAAAAAC
TGATTGGGCCCAAGCCCCATTCACAGCCTACTATAGAAACTACATGGCCCAAAGCTTTAGCCCATCACAATTTTCTGATCAAAAATGGCAAAATC
AAGAACTTGATTCTAATGGCAGAAGAAGACTTAGATGGGTTCAAAAGAATTTCATGATTTATAATTATTGTACTGATATTAAGAGGTTTCCTCAA
GGTTTTCCTCCAGAATGTAGAAGATTTTGAGAGGGTTATGTAGTTTTTTTTTTGTTTTTTTTTTTTTTTGGGTGAAATTCTTTCATGTGTTTGTG
GTTTTATTTTGATAGATTGTTAGCCAACTAAAATAAATTAATATGTTTTTTCTTTGTTTAATTTTGTATGTTAATATGAAGGTAGCTAGAAGTTT
ATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393214] SGN-U579477 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194540 [Download][View] Facility Assigned ID: FA0AAD26AF04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5