Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E394815

Search information 
Request: 394815Match: SGN-E394815
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183580Clone name: TUS-42-I18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183580 is on microarray TOM1 spot ID 1-1-7.1.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183580 [TUS-42-I18] Trace: SGN-T196141 EST: SGN-E399280 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394815Length: 408 bp (885 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E394815 [] (trimmed) AATTAGATGAACCATATATCTATTGAAGGGATGAATACAATATTTCACAAAGCAAAGTGAATTTGACAAAACATTTGAAAATAACATAGGAAAAT
GACAACACATATTGTACTAGTACATCATATAGGGACATAGGGTATTTACTGTGTTATGTTTTACCAATTGGAATTTATACGCAGTAAAACTTCCT
TAAGTACCATATACTTACTATATAGAACATATAAAGGTAATTTAATTATCTTTATAATTGGATTATTTCTCGTTTTGTGCGTGTCGGGGTCATGC
TAAAGGACATTTATCTCGGCGATTTTACTGATTCAACTTGACATTTTCCTCTAGGTCCGTTTGTTCTAATGAAAGCCCAATACTCATTGAAGGTC
GGACAATAAATATATTCCTCGCTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394815] SGN-U564993 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196141 [Download][View] Facility Assigned ID: FA0AAD30BE09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5