Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395448

Search information 
Request: 395448Match: SGN-E395448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173415Clone name: TUS-16-B5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173415 is on microarray TOM1 spot ID 1-1-4.2.18.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2510 [cLEC-16-E19] Trace: SGN-T26823 EST: SGN-E204934 Direction: 5' Facility: TIGR
Clone: SGN-C173415 [TUS-16-B5] Trace: SGN-T196661 EST: SGN-E395335 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395448Length: 679 bp (883 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395448 [] (trimmed) AAGTGCAAAAATCTAGTAATGGAACTTCCAATAATAAGCCTGTGAGTTATATGACAAAGGATCAAACTTAAATGTTAAGGATTACACAAAATGGA
CTGGCTTACACCATGAAAGAATCTGCAAAAGATGGTTCAAGGTACTTCTTTTCCAGGACACAACAAAAAACTCAATTAAATTGTTCTCTCCTTTC
TATAAAACAAAGCTAGTAATAGTAGCCAATTTCACAATCTTCATATTTCCATGCTCCCAGATACCCAATGTGATCAAGGCTAGCTCTACTAACAG
ACAACAACAACATACCCAGTATAGTAGCGCAGGTGAGATCAGGCTAGTTCTACTCACAGATGTATTTATTACATAAAGAATATTATGCAGCAAAC
AAACTCATCTCAGTTGCAATTTCGTGACTTATGACCTGAAAATCAGTAGCCGTGTCGCTTTCGTCTATTGTCTTCTGGTCTGCCTCTTCTTGATG
AAAAGGCTGTTTTTGAATCACCAGTCTTCTTGGTATATCCATGTTTGAGAGCTACGATTGGATTTAAGTACATCATTCCAGGAGAGTGTCTTTTC
TCTCTTGGAAGTGCTCTTAACTCTGGTAACCAGTATGCAACAAACTCCCCTTCAGGATCATAATTTTGAGCTTGCTTCGGAATGCTGAAGTAACG
GTCTTCTCTCCGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395448] SGN-U583650 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196774 [Download][View] Facility Assigned ID: FA0AAD4CA03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5