EST details — SGN-E396293

Search information 
Request: 396293Match: SGN-E396293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185240Clone name: TUS-46-N22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185240 is on microarray TOM1 spot ID 1-1-3.2.11.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C111124 [cLPT-7-J4] Trace: SGN-T179143 EST: SGN-E367581 Direction: 5' Facility: TIGR
Clone: SGN-C185240 [TUS-46-N22] Trace: SGN-T192283 EST: SGN-E390957 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396293Length: 564 bp (851 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396293 [] (trimmed) GGTTTCATCCCCACCTCCTGTTGTAACTTCTCCACCACCAGCACCTCCTACTCCTATTGCTTCTCCTCCTCCACCAGTGAACTCTCCACCTCCTC
CAGCAGCACCTTCTCCTGCGCCACTTGCATCAACTCCTGCTCCAGCTCCTGCGAAGAAATTGACTTCTCCAGCACCATCTCCTTTAGGATTTAGT
CCTCCCGCCCCAGCCCTAGCCCCAAGTCTTGGAGCTTTATCTCCTGCTCCTTCAGCTACTGATCAGAGCGGAGTAGAGGGCCTGAAATTGTCAAC
AATGATCGTGAAAAGCTTGGTCTTAGGATGGGGTCTACTCAGCTTTCTAATGTAGAACTCTCTTTCATCCTGCATCATTTGTCTTAGTTTGCCTC
TATATGTATGAATTGGTATCTCTTTATTTAGCTTAGGATGATGATGATGATGACCCATTTCCTTGCCTGTACTTGGATTATATATTCACTTTGAT
TTTTTTGGAGGATTTGTTAAGGGGAGCTTAATTTTTGTATTTTGACAGGATTGTGTTTTAATTGAAGTTTCTAATATATTGTTTTATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396293] SGN-U572871 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197619 [Download][View] Facility Assigned ID: FA0AAD34DG11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5