EST details — SGN-E397853

Search information 
Request: 397853Match: SGN-E397853
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181180Clone name: TUS-36-E18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181180 is on microarray TOM1 spot ID 1-1-7.1.14.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24858 [cLED-9-N7] Trace: SGN-T51001 EST: SGN-E233440 Direction: 5' Facility: TIGR
Clone: SGN-C181180 [TUS-36-E18] Trace: SGN-T199219 EST: SGN-E397893 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397853Length: 558 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397853 [] (trimmed) TTCCATTACTTATGTTGATGAAATCTCATGGTAAGCTTGTTATGGTTGGTGCACCAGAAAAACCGGTGGAGTTGCCCGTGTTTCCTCTACTTATG
GGAAGGAAGCTAGTGGCTGGAAGTTGCATAGGAGGGATGAAAGAGACTCAAGAAATGTTGGACTTTGCGGCAAAGCATAACATAACACCAGATAT
TGAAGTGGTGCCAATGGAGTACGTTAACACCGCGTTGGAACGTCTTTTGAAATCGGACGTGAAATATCGTTTTGTGCTAGACATTGGTAATACAT
TGAACAAGAAATGAGAATAGGGAGGGGATCAATTATGTAGCTAGCAGTGTTTCCTCCATCATCTATTTATACTGCAGTAACTGAGATTTAGTGAA
TACCTTACAGAATAACAACCCTTTGCCTTTACTCTATTAACTAGGGGAAATCCGTATATCTCTGATACATCTTTTCACATGAAAATCATACAACA
AAGTCAAATTCTGAACTTAGTACTCAAGAAAACAGCTTGCACTAATGAATTATGACGGAACACCACGATATGATGCAAGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397853] SGN-U572059 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199179 [Download][View] Facility Assigned ID: FA0AAD24BC09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5