EST details — SGN-E398254

Search information 
Request: 398254Match: SGN-E398254
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172669Clone name: TUS-14-C3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172669 is on microarray TOM1 spot ID 1-1-6.3.20.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172669 [TUS-14-C3] Trace: SGN-T195098 EST: SGN-E393772 Direction: 3' Facility: INRA
Clone: SGN-C172669 [TUS-14-C3] Trace: SGN-T195297 EST: SGN-E393971 Direction: 3' Facility: INRA
Clone: SGN-C172669 [TUS-14-C3] Trace: SGN-T195297 EST: SGN-E398900 Direction: 3' Facility: INRA
Clone: SGN-C172669 [TUS-14-C3] Trace: SGN-T200165 EST: SGN-E398901 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398254Length: 677 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398254 [] (trimmed) GTTGTCTTTGCAAAACCAGCAAGGTGAGACTGCATTATATATTGCTGCAGAAAATGGACATACTTTAGTTGTTGTAGAGATTTTGAAACATTTGG
ACCTTCAAGTTGCTTCTCTTGTTGCAAATAATGGATATGATGCATTCCAAGTTGCAGCAAAGCAAGGTCATCTTGAAGTACTGAAGGAACTATTG
CATTCGTTTCCAAACTTGGTTATGGCTACAGATTCATCCAATTCTACAGCCTTACATACAGCAACTGCCCAGGGTCATGTTGATGTCGTAAATCT
GCTTCTGGAGATTGATTCGAACCTTGTTAAGATAGCTCGGAACAATGGGAAAACTGTGCTCCATACAGCAGCAAGAATGGGACACTTGAAAATTG
TTAAGTCCCTTCTGAGCAAAGATCCTGACATTGGCTTTAGAACGGATAGTAAAGGCCAAAGTGCCCTGCACATGGCTGTAAAAGGACAAAATGTT
GGCATTGTGCTCGAGTTAATAAAACCGAATTCTTCTGTATTGACCTTGGAAGATAACAAAGGAAATAGAGCTCTTCATATTGCAACAAAAAAGGG
ACGGCCACAGATGGTACAATGTCTTATATCAATTGAATGCATCGATCTGAATGCCATTAATAAGGCTGGAGAAACAGCTCTTGATATTGCTGAAA
AGTTTGGAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398254] SGN-U586261 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199580 [Download][View] Facility Assigned ID: FA0AAD2AB02RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5