EST details — SGN-E398576

Search information 
Request: 398576Match: SGN-E398576
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180951Clone name: TUS-35-L5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180951 is on microarray TOM1 spot ID 1-1-4.4.17.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C66368 [cLEN-13-P22] Trace: SGN-T90175 EST: SGN-E274872 Direction: 5' Facility: TIGR
Clone: SGN-C180951 [TUS-35-L5] Trace: SGN-T196409 EST: SGN-E395083 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398576Length: 524 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398576 [] (trimmed) CTACAGAAAGTTCTCTCCCAGGAGTTGAGATAAAGTGAAAATACCACCCCTACAAGAGATAATTATATTGAATGTTACTACAACCTAATATTTAT
GATATACATTTATATCAATACAACAACATTTCTTCTTCCTTTTTTTCTTCTAATGTATATTGCTATATATATATATATATATATCTTCATTTCAT
GCTTTATCTTTGAAAAGAGGCAGTTTTTGTAGGAGGCACAAGAAATTTTGCATATGCAATAGGTAATGCAATCAACTTCTTTGATTTGCTCACAT
ATGCTCTCTTTGTGAAGATGTTGTATTCATTGGCTTCAATCTCATCAAATATTTTGCGGTACAAGACCAAAGATGCCCATACAGGGAATCTACTA
ACTAAACTCAATTCTGTCACACCTTTCTCTGCCTCATCAAAGAACTTTCTTGCCCTATGTATTTGTTTCTTCATAAAGATTCTCCATTTATCAGT
CACCCTTCCATCAAATATAATCTTCATCGGATAAACCTGCCTCGGCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398576] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199902 [Download][View] Facility Assigned ID: FA0AAD23CF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0203 Quality Trim Threshold: 14.5