EST details — SGN-E399876

Search information 
Request: 399876Match: SGN-E399876
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C205494Clone name: cSTC-2-J20
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399876Length: 582 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E399876 [] (trimmed) CTAAAGCCTGACATTCATATGCTTCTCCGCCACTCTCAGACCAGCAATTTTTGTTGCTCAAAATTGTCACCAATTGCTGCAATTTCGAAGCATAC
TCTCAGATTACCAGCCTTGAGATTCAATTCAATCCCTCCTCTTCTTCATATTTCCATGGCTGATTCTACTTCTAGGGTTATATCGCAGCCTGAAT
GTGGCGGAGATGCGAAATCTGAAAATGTGAGTCCTAGTTTCACTGAGATTATCGTAATCCGTCATGGTGAGACGGAATGGAACGCTGATGGCAGA
ATTCAGGGACATTTAGATGTCGAATTAAATGACACCGGAAGACAGCAAGCTACTGCGGTGGCAGCCCGGCTCTCCAAGGAGCCAAGGATCTCTGT
CATATATTCATCTGACTTGAAACGGGCCCATGAGACAGCAGAGATAATAGCAAGGAGTTGTGGGGATCTAGAGGTCATTAAAGATCCAGACCTTC
GAGAGAGAAATCTCGGAGATCTTCAAGGTATTTCGCTCCGTGAAGCAGCCAAAAGCCAACCGCTGGCTTATAAGGCTTTTCTCTCTGACCGAAAT
GATCAAGTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399876] SGN-U274422 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200749 [Download] [View] Facility Assigned ID: PSEAH58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5