EST details — SGN-E400256

Search information 
Request: 400256Match: SGN-E400256
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C205954Clone name: cSTC-6-E15
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400256Length: 574 bp (757 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E400256 [] (trimmed) GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTACACAATTAAAATATTATTTATTTCTCACAGTTGCAATGACTAATAGACTAATAGCTTC
CCCGAAACTTAGTAAGGTTGATTGCAACAAAATTAACCAGTACAAACCAGAAGAAAACACAAAAATCTAAACATGAAGGATAAATATTCTCAAAT
ATCTAATAAACACGAACCAGGTCAAGTCTAGTGCTGCCAAGAGGCATCGGACATAGCAATTGTAAAGCACAGTACAAAATTGACGACCACATTCA
GTTGTTGCAGCTCGATAATGAACTAAAACAAGATTAACCAAGTGTTCTTTCAACAACTACATAAATCAAGAAAAGAGGGCCTGATAGACTGGAAT
TCAGAAGAATTACTGCTCCTTGGTGTAGTGTCGTACTGTTAAGGCCAAGCCCAAGATCAAGATGGGTACAAGGAACTGTAGGATTTTGATAATGA
ATTCTGGAGTCTTGTCTGGATTGTATGCAGTTTGTTCCGATGGAATAGAAGCACGTTTTAGGGGAACTGTTGACATGTCAATTTCCCCAATGTAA
TACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400256] SGN-U270106 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201129 [Download] [View] Facility Assigned ID: PSEAU32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5