EST details — SGN-E400323

Search information 
Request: 400323Match: SGN-E400323
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206014Clone name: cSTC-8-E14
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C206014 [cSTC-8-E14] Trace: SGN-T201197 EST: SGN-E400324 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400323Length: 554 bp (914 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E400323 [] (trimmed) CGGAGAAGAAGGTTCAAAGCGGCCACCGTCTTATGGAGCAGATATTTATCTGATACTGTAAAACGGTATCGCCAAAAGAAACAATTTCAAGAACA
CAGTCAACAAGATTTCTTGTTTCTTGGAAAAGATAAGTGTTCTTCTAAAACCCTAATTGAGAGAGATTATAGTTTTTTTCAAGAAAGAAGTGACA
ATTACATCATGGGGAAGAAACAACACAGTAAAGATCGAATGTTCATAACCAAGACAGAATGGGCAACTGAATGGGGTGGCGCTAAATCCAAAGAA
CTTAAAACCCCTTTTAAACGGCTTCCCTTCTATTGCTGCGCTCTTACGTTTACACCGTTCGAGGACCCAGTATGCACAACAAAACTGAAGATGAA
GACAATGAGAAGGTTGGATCATGGTACAGCAACCCTGGAACTGGAACCTCAGATATTCAAGCTGTTGGCAGTGGTATTGGGAAGTATTTGAAAGC
AAGGGCTGCACAGGCCGATTCCAAAACTTCTTCTGATAGCAGTCTGCCACCTATTTATGCAGCANAGAAGAGAAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400323] SGN-U277934 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201196 [Download] [View] Facility Assigned ID: PSEBD31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5