EST details — SGN-E400335

Search information 
Request: 400335Match: SGN-E400335
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206032Clone name: cSTC-8-G12
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C206032 [cSTC-8-G12] Trace: SGN-T201209 EST: SGN-E400336 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400335Length: 286 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E400335 [] (trimmed) CTAATATCTCTCCATTGCCTCAATCTTTTTCTCCTGCATACTTTTAGAGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACACTTATGAG
AATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTCCATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTTGCTCGTCGTT
TGAAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATGAGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGCGGAT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400335] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201208 [Download] [View] Facility Assigned ID: PSEBD42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5