EST details — SGN-E400338

Search information 
Request: 400338Match: SGN-E400338
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206034Clone name: cSTC-8-G16
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C206034 [cSTC-8-G16] Trace: SGN-T201212 EST: SGN-E400339 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400338Length: 307 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E400338 [] (trimmed) CTAATATCTCTCCATTGCCTCAATCTTTTTCTCCTGCATACTTTTAGAGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACACTTATGAG
AATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTCCATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTGCTCGTCGTTT
GAAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATGAGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGCGGATC
TTANGGTTATGGNNTATTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400338] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201211 [Download] [View] Facility Assigned ID: PSEBD44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5