EST details — SGN-E400339

Search information 
Request: 400339Match: SGN-E400339
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206034Clone name: cSTC-8-G16
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C206034 [cSTC-8-G16] Trace: SGN-T201211 EST: SGN-E400338 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400339Length: 354 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E400339 [] (trimmed) TTTTTTTTTTTTTTTTTTGAAGAGAAATAATAACTTTGCAATGAAATCTTACATATAAACCTTAACAAGATTAAAATTTTGATTACATGATCATC
AACAGCAAGATCCTGAACTAGGTAAAAAAAACAAGAGAGGATCCACTGGCAGTTATTCAATTCTCACATTGAGATCTTCTCGAACGACTGATAAA
TATACTATTAAACTATCATCCCCTTCACAAGACCCAGGGGTAATAGATTACATTGACATGTTCAAACTAAAACCAAGAAAAGCCAACAATTACCA
GAACTTAACACATCTTCTACGACGCCNTANTACATAATGCAGCAATGTCATAGCAGAGGGATTGGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400339] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201212 [Download] [View] Facility Assigned ID: PSEBD44TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5