EST details — SGN-E400368

Search information 
Request: 400368Match: SGN-E400368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206062Clone name: cSTC-8-M10
nocartOrdering Not Available
Library Name: cSTCOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E400368Length: 325 bp (1012 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E400368 [] (trimmed) TTTTTTTTTTTTTTACAAAAAAAATGATATGCTCTTGCACGATTATTCTTTTCTTTTTTTTCCTTTTTGGGGTACATTTTTTTTTCTTGGATACA
AACACTGTCGGCAGAACAAAAAAACAAACTTAAATACAAATGAAAAAATTGATAGGTAATTACAGTATTTATAACAAAATAAAACAAAAGATATT
TTCTCCCTTCTCTTGCTTTTTTTTTTTTCTACTTCAATTCCAAGCATTTGTTGTCCTTCCTTGCCCATTTTATGTTTTATCATATGATCACATAA
GCCCTCCTAATAACATGCTTTTTTTCATTTCTTTATCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E400368] SGN-U271119 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201241 [Download] [View] Facility Assigned ID: PSEBD77TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.852 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5