EST details — SGN-E400900
| Search information |
| Request: 400900 | Match: SGN-E400900 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C264927 | Clone name: PPC-2-B3 |
| ||
| Library Name: PPC | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6 week old
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E400900 | Length: 241 bp (1007 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E400900 [] (trimmed)
GAAGTTGAAAAAAAAAATGGAAGAAGTAAAATTGTTAGGTTTTTGGGTAAGTCCTTTTAGTATAAGAGTTGAAATGGCCCTAAAACTTAAGGGTA
TTGAATATGAGTACATTGAAGCACAACTTCCAATTAAAAAGTGTCCTAATATTGGTCAGTATAATCCTATTTACAAAAAAGTTCCAGTATTTTTG
CACAATGGAAAGCCAATTCCTGAGTCTCTAGTGATTCTTGAATATATTGAT
TTGAATATGAGTACATTGAAGCACAACTTCCAATTAAAAAGTGTCCTAATATTGGTCAGTATAATCCTATTTACAAAAAAGTTCCAGTATTTTTG
CACAATGGAAAGCCAATTCCTGAGTCTCTAGTGATTCTTGAATATATTGAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E400900] | SGN-U279172 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T258471 [Download] [View] | Facility Assigned ID: PPCAG02TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.884 | Expected Error Rate: 0.0247 | Quality Trim Threshold: 14.5 |
Working
