EST details — SGN-E400944
| Search information |
| Request: 400944 | Match: SGN-E400944 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C265080 | Clone name: PPC-2-J11 |
| ||
| Library Name: PPC | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6 week old
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E400944 | Length: 191 bp (995 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E400944 [] (trimmed)
TTTTTTTTTTTTTTTTTTTTTTTTGAAGCCACAAAGATTGTTGCATCTCTGATTTGTTATCTTTCTATGCACAATTGCTGCCCCAGAAACAGAAT
ACTGGAACTTCACAACTGTTGAATCAAGTCTCTCTAATAAAAGTGATACCTAACTAAGAGAAACAACACTTGTAAATTGTTTATAAAATCAAAAA
T
ACTGGAACTTCACAACTGTTGAATCAAGTCTCTCTAATAAAAGTGATACCTAACTAAGAGAAACAACACTTGTAAATTGTTTATAAAATCAAAAA
T
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E400944] | SGN-U274252 | Solanum tuberosum | Build 4 | 7 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T258515 [Download] [View] | Facility Assigned ID: PPCAG54TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.869 | Expected Error Rate: 0.0003 | Quality Trim Threshold: 14.5 |
Working
