Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E401521

Search information 
Request: 401521Match: SGN-E401521
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C265795Clone name: PPC-4-O12
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E401521Length: 461 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E401521 [] (trimmed) TAAAAGAAAATGGAGTCAAAGTTTGCTCACATCATTGTTTTCTTTCTTCTTGCAACTTCCTTTGAAACTCTCATGGCAAGAAAAGAAAGTGATGG
GCCAGAAGTCATAAAACTTCTAAAGGAATTGGAATCTGAATCTTGGTGCAAAGGAAAACTATTCTGGCCAGAACTTATTGGTGTACCAACAAAGC
TTGCTAAGGAAATAATTGAGAAGGAAAATTCACTCATAAATGATGTTCAAATAATATTGAGTGGTTCTCCAGTCCCATTGGATTATCGTTGTAAT
CGAGTTCGTCTTGTTGATAACATCTTGGGTTCTGTTGTACAAATTCCTGTGGTTGGGTAATTAATGGATTATTGAAGTAAGCAGCCACATGTCAA
AAATAATTAGGGGTCATGTTGATTATAATGTCCTCATGCATTCTTATATATATATGGAATGGAACAAATTTGTGTGGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E401521] SGN-U268406 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T259092 [Download] [View] Facility Assigned ID: PPCAN90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0156 Quality Trim Threshold: 12.5