EST details — SGN-E401597

Search information 
Request: 401597Match: SGN-E401597
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C265817Clone name: PPC-4-P13
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E401597Length: 406 bp (881 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E401597 [] (trimmed) TTGCACTCTTCTTTAATCAGGGCCAATGTTGTTGTGCTGGTTCTCGTACCTATGTACATGAACGAGTATATGATGAATTTGTAGAGAAGGCAAAG
GCACGTGCAATGAGACGTGTAGTTGGTGATCCCTTCAAGAAAGGTGTTGAACAAGGTCCTCAGATCGACTCGGAGCAATTTAAGAAGATACTTAG
GTACATAAGAGAAGGCCGTGACAGCTCTGCCACCCTTGAATGTGGTGGTGATAGAATTGGCTCCAAAGGCTACTTTATTCAGCCCACTGTGTTCT
CAAATGTCAAGGAGGACATGTCGATAGCACAGGATGAGATTTTTGGTCCAGTGCAATGTGTCTTCCAATTCAAGGATATTGGCGAAGTAATAAAG
AGAGCAAACAACACTCGCTATGGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E401597] SGN-U269701 Solanum tuberosum Build 4 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T259168 [Download] [View] Facility Assigned ID: PPCAO91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5