EST details — SGN-E402099

Search information 
Request: 402099Match: SGN-E402099
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C266301Clone name: PPC-6-M4
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E402099Length: 311 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E402099 [] (trimmed) GGAAAAAGATCAATTGAGGGATGAGATTAAAGCTGGTTATTGGACTGTAGCTGCTTGTAGCCCAAGTGTAATTGGGCTTTCTGATGTGGGAAGTG
TTGGGCTTTGGGATGAAGTTCTTGGGCTTATGACCCATAAGAAAGTTTGGTGAGCTGAAATGATCATTTAATTTGTAAAGAGAGGATATGGGTTT
CTGTATTAATTGTAGCTTGAACTTTTGAGTTAGATTTGTGTTGTTGAAAGTAGAAGCCCAAATATTGTAAATTATTATGCATTGAAATCCTATGA
TTTTTTAACCAATTAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E402099] SGN-U272738 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T259670 [Download] [View] Facility Assigned ID: PPCAV74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5