EST details — SGN-E402270
| Search information |
| Request: 402270 | Match: SGN-E402270 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C266341 | Clone name: PPC-7-A16 |
| ||
| Library Name: PPC | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6 week old
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E402270 | Length: 166 bp (875 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E402270 [] (trimmed)
GAGGATACTAAATTTCATCAAACCTATAATTAATTACTCCTATCGACATGTTTTTTGCGTTTTGTACCGGTGTATTTTCCTCGATTCCGACCAAG
TTATGAGAAATTAATAATGATGAATCTTTAATTAAAAAAAAAAAAAAAAAACTCGAGACTTAGTTCTCTCT
TTATGAGAAATTAATAATGATGAATCTTTAATTAAAAAAAAAAAAAAAAAACTCGAGACTTAGTTCTCTCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E402270] | SGN-U281209 | Solanum tuberosum | Build 4 | 108 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T259841 [Download] [View] | Facility Assigned ID: PPCAZ08TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.899 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |
Working
