EST details — SGN-E402359
Search information |
Request: 402359 | Match: SGN-E402359 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C266365 | Clone name: PPC-7-B17 |
| ||
Library Name: PPC | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6 week old
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E402359 | Length: 201 bp (855 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E402359 [] (trimmed)
CCTTAATGATTTCTATGCTGTTCCTGCATTAGCATGCAAATGTGTCAATATTATGATATCGAGTATGAAGAGTTGTAGCTAATACCCACTAGAAT
TATTCTGCATTAGTTTCTTGTACTTGTGCTAGCTAATGTTATATAGCCAGACTAGAGCTATTTTCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA
TATTCTGCATTAGTTTCTTGTACTTGTGCTAGCTAATGTTATATAGCCAGACTAGAGCTATTTTCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E402359] | SGN-U271434 | Solanum tuberosum | Build 4 | 7 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T259930 [Download] [View] | Facility Assigned ID: PPCBA09TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.877 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |