Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E402441

Search information 
Request: 402441Match: SGN-E402441
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C266362Clone name: PPC-7-B14
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E402441Length: 440 bp (850 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E402441 [] (trimmed) TTGATGAGTATGGATGATTCATTTGATGAAGAGTGTGATTATTTATTCAAGTCAGTTCTTGTTGGAGACTCAGCTGTGGGGAAATCAAATCTTTT
ATCAAGATTTGCAAGAAATCAATTTCAGCTTGATTCTAAGCCAACTATAGGTGTGGAATTTGCTTATAGAAATATTAGAGTTGGTGATAAACTCA
TCAAGGCTCAAATATGGGACACTGCTGGACAAGAAAGGTTTAGAGCAATTACAAGTTCATATTATCGCGGAGCCCTTGGTGCTTTACTTGTCTAC
GACATAACAAGAAGGACAACATTCGAAAATTTAAGAAAATGGCTACATGAACTTAAGGAATATGGAAGTTCAGACATGGGAATTGTTCTTGTTGG
GTAACAATCTGATTTATCCAATTCTTTCAAGACAAGTAAATATTTGAAGATGGGACAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E402441] SGN-U277836 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T260012 [Download] [View] Facility Assigned ID: PPCBB07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5