EST details — SGN-E403993

Search information 
Request: 403993Match: SGN-E403993
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C263368Clone name: PPC-12-I8
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E403993Length: 393 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E403993 [] (trimmed) GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAAACAAAGCACCAAATCATCATATAATTAGGTCCTCATAAATCCAAAGCATAAACCGAATA
GTAAATTATTAAGAAAACATAAACAGTTTGTTGGAATTAAGAAAAAAACAAAAAAGAAACCGAGAAGTTCTCGGGGCAAAATTCCTAAGTGATGG
ACAGCCTGGGACTGCTCAAAATGTCGATAAATCGACTAATTTAGCAAGGAAGCTATTCCGTCTCTTCAAGGTTATCAATGAACTTCATGGTCTTA
TTAACCCAAATGCGCCCAGGAACCCCCCTTCCACTCTTCTTGTTGGGAAAGTCGAAAAATGCGTTACTATCAACTTACTTGTTTCTGGAGAAATT
TGTTTGGCTTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E403993] SGN-U281367 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T261564 [Download] [View] Facility Assigned ID: PPCBT52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0263 Quality Trim Threshold: 14.5