EST details — SGN-E404081

Search information 
Request: 404081Match: SGN-E404081
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C263387Clone name: PPC-12-J7
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E404081Length: 380 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E404081 [] (trimmed) CCGTACCAAGCAATGGCGCAGTTGATTACACAAATTGGGCTGCTGGAAAAACATTCAGAGTTGGCGATACTCTAGTGTTCAATTTTGCGACTAGT
CGACATGACGTGCAACAAGTAGAAGAAACTTCGTTCGATGGATGCAATTCGCAGAATGCAATAGGCGCTGCCATAATGACAGGACCAGCAAATAT
AACTCTTAATTCTACTGATGATCACTATTTCATTTGTACTTTTGGCACACACTGCCCAGATGGACAGAAATTATAAATTTCAGTTTCCGACGACA
GCACTAATATTTCAGGGACCCACCCACCTACACCATCTGGTGATGGACCTACAAGGTCCGGTCCCCGGGGTGGCGGTTCTCCTCCTCCTCCGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E404081] SGN-U288903 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T261652 [Download] [View] Facility Assigned ID: PPCBU52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0194 Quality Trim Threshold: 14.5