Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E405240

Search information 
Request: 405240Match: SGN-E405240
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C264574Clone name: PPC-17-G23
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E405240Length: 681 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E405240 [] (trimmed) GCCGAAATACTATTCCCATTTTTTCAGAAAGAAGAAGAAAAATTCAATCGCCGATCGATCAATAAAGATGAGTTTCCTATTCGGCAAGAGAAAAA
CTCCGGCAGAACTCCTGCGTGAAAACAAGCGTATGCTTGATAAATCTATCCGAGAAATAGAAAGGGAGAGACAGGGCTTACAAACACAAGAAAAG
AAACTAATTGCAGAGATAAAGAAAAGTGCAAAGCAAGGACAGATGGGCGCTGTGAAGGTGATGGCGAAAGATCTTATCAGAACAAGGCATCAGGT
TGAAAAATTTTACAAGCTTAAGTCCCAACTTCAAGGCGTCTCCCTCAGAATTCAGACTTTGAAATCAACACAAGCAATGGGTGAAGCAATGAAAG
GCGTTACAAAGGCAATGGGACAGATGAACAGGCAGATGAATTTGCCGGCATTGCAGAGAATAATGCAAGAATTTGAGATGCAAAATGAAAAGATG
GAAATGGTGAGTGAGGTGATGGGAGATGCCATTGATGATGCTTTGGAAGGGGATGAGGAAGAAGAAGAAACTGAAGAGTTGGTGAGCCAGGTCCT
TGATGAGATTGGAATTAATATCAACAATGAGCTTGTCAATGCTCCTTCTTCTGCGGTGGCTGCTCCAGCAGCGAAAGGGCAGGTTGCACAAGCTG
AGGCAACTGACAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E405240] SGN-U274387 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T262811 [Download] [View] Facility Assigned ID: PPCCM48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5