Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E406740

Search information 
Request: 406740Match: SGN-E406740
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C260817Clone name: PPI-4-F22
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E406740Length: 550 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E406740 [] (trimmed) TGTCGTGTTTTGCCTTTCCGGCATCGAGAATGAAAGCCGGAAAAGCTCAGATGTAGAAATTCACCTCCGTCGTATGCGGCGGCGGCGGCGGCTAG
GTGTTGTTCTCCAGCTTTGGGATATCCAGTCGGCGGAAGGAAAGACGGTGGAAAGTTTTATTACCCTTGCTGTGACCATGGAAGCCCTAGGCATC
TTTACTATGTTGCTCAACGAAACCATAGCCAGTAGAAATTAAATTGAAGATAATAAAAACAATTAAGTTATTTCAAAACGTATATGAGTAATTGA
GCACATAGACAAACTGAAGCTCCTCCTCACAAAGATGAAATTATATACAATGACAAACGCTACTGCGTATATTCTATCCTCTCGACCTTGGTATG
ATGTTTGTTGTTATTGACAAATGCCTTGGGTTCATTGAATTGGATTGTACATTATTTGAGACTGCAGTTCAATTCAATCGCGAGGTGAATTTGAC
GTATGTTTGCCCATTTTTGGACTTGTTAATNACACAGCCGTGTTATGGTTCGGCGTTTGCCGTCATACACTCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E406740] SGN-U275166 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T253815 [Download] [View] Facility Assigned ID: PPIAP35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0103 Quality Trim Threshold: 20.5