EST details — SGN-E406826

Search information 
Request: 406826Match: SGN-E406826
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C261184Clone name: PPI-5-I7
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E406826Length: 228 bp (1003 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E406826 [] (trimmed) TCGCAAATCAGGTAGTCCATTCTTGCAACCTATGTTTCAAGCTCCCGGATAATATAAGTTTAGAAGAGGGAGCAATGTGTGAGCCACTTAGTGTT
GGTGTTCATGCCTGTCGGCGTGCAAATGTTGGTCCCGAGACAACTTATTAGTGCTGGGAGCTGGACCGATTGGGCTTGTCACACTGCTTGCTGCT
CGTGCTTTTGGTGCCCCAAGAATTGTTATTGTGGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E406826] SGN-U275174 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T253901 [Download] [View] Facility Assigned ID: PPIAQ52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0222 Quality Trim Threshold: 20.5