EST details — SGN-E407054

Search information 
Request: 407054Match: SGN-E407054
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C261203Clone name: PPI-5-J4
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E407054Length: 676 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E407054 [] (trimmed) GCACGTACTTGATAAGATTCGAGACTTCTCTGAGAGGGTTCGCAGTGGTGCCTGGGTTGGAGCCACAGGAAAAACACTGAAAGATGTTGTAGCTG
TTGGTATAGGTGGCAGTTTCTTAGGCCCTTTGTTCGTACACACAGCACTTCAAACAGAAGCGGAGGCTAGTGAGTGTGCAAGAGGGCGCCAGTTG
CGATTTCTCGCAAATGTTGATCCCATTGATGTAGCCCGAAATATAACAGGCTTGAATCCTGAAACAACTCTAGTTGTGGTGGTCTCGAAGACTTT
TACTACTGCCGAGACAATGCTAAATGCCCGTACAATGAGGGAATGGATCTCCTCTGCATTAGGACCCCTGGCAGTTGCAAAGCATATGGTTGCAG
TTAGTACCAATCTTAAGCTCGTAGAACAATTTGGCATCGATCCAAATAATGCATTCGCTTTCTGGGACTGGGTAGGAGGTCGATATAGTGTCTGC
AGCGCAGTTGGAGTATTGCCTCTTTCTCTGCAATATGGATTTTCCATTGTTGAGAAATTTCTGAAGGGAGCTTCGAGTGTTGATCAGCATTTCCT
CTCAGCACCATTTGAGAAAAATATACCTGTGCTTTTAGGCTTGCTGAGTGTGTGGGAATGTTTCATTCCTTGGATATCCAGCAAGAGCAATATTA
CCCTATTCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E407054] SGN-U270415 Solanum tuberosum Build 4 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T254129 [Download] [View] Facility Assigned ID: PPIAT50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5