EST details — SGN-E408246

Search information 
Request: 408246Match: SGN-E408246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C257299Clone name: PPI-10-F19
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E408246Length: 241 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E408246 [] (trimmed) CAACTTTTCATTTCTACAGAGATGGTGAGAGGGTTGATGAGATGTTTGGTGGAGGAGACGAGCGCTTGCATGACCGTCTGTGGTTGCATTCGTAG
ATGAATGAATGCTTTCAATACCAAACTTTTGTATGACAGATGACCAAACTTTTATCATATTTCTAGGAGAAAAGACATAAAGTCACTACTAAAGT
TGTCTCGTATTTGCATAAAAACACATTAACTTTGGAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E408246] SGN-U274042 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T255321 [Download] [View] Facility Assigned ID: PPIBM34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5