EST details — SGN-E408456

Search information 
Request: 408456Match: SGN-E408456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C257721Clone name: PPI-11-K19
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E408456Length: 699 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E408456 [] (trimmed) TGCGTGTGCAAAACAATTGATTGAGAGGCTGGTCTATGCTGAGGGTGCGGAGAATGGCTTAGAGTTCACTATTGTAAGGCCATTTAACTGGATTG
GTCCTAGGATGGATTTCATTCCTGGCATCGATGGTCCTAGTGAAGGTGTTCCAAGAGTATTAGCTTGCTTTAGTAATAACCTTTTAAGACGTGAA
CCTTTGAAACTTGTGGATGGGGGAGAATCACAAAGGACGTTCATATACATCAAAGATGCTATTGAAGCTGTTCTTCTAATGATCGAAAATCCTGC
CAGAGCCAATGGCCATATCTTTAATGTTGGTAACCCTAACAATGAAGTTACTGTCAGGCAGCTGGCTGAAATGATGACTAAGGTGTACTCAAAGG
TGAGTGGAGAGTCTTCTATTGAAACACCCACCATTGATGTAAGTTCTAAAGAATTTTATGGTGAGGGGTATGATGACAGTGACAAGAGGATTCCG
GACATGACCATAATCAACAGGCAGCTTGGTTGGAACCCAAAGACTTCCCTATGGGACTTGCTAGAATCCACACTCACATACCAACACAGGACCTA
TGCCGAGGCTGTCAAGCAGGCCATGTCTAAAACAACAGCAAATTGATTGTTCGCTGCTTGTTGGCAGGTCTTTCAATATCTTGTTACGATTCTCC
CCGAGTAAAATCTACAGTCCATCACTCATACTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E408456] SGN-U269030 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T255531 [Download] [View] Facility Assigned ID: PPIBO70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5