Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E410226

Search information 
Request: 410226Match: SGN-E410226
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C259471Clone name: PPI-16-M6
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E410226Length: 630 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E410226 [] (trimmed) CTGGTGTTGGTGCTTTTGGTCACTTGAGGTTGAGGTGCTCGACTTGCTTAGTGCTAAAGAAATTGCTGTACGAGCTATCGATGAGACCCACAATA
CTCAACCCGAGAAGCTTATTTGGAACGTCATGGGAATGATGAACAATTGTTGGTTTCGAGTGAAGATGAATGTGTGCAAGCCTCACAAGGGAGAG
ATTGGTATAGTGTTTGAGCACCCGACCCAACCTGGAAACCAATCAGGTGGATGGATGGCAAAGGAGAGACACTTGGAGATATCAGCAGTGGCTCC
TCCAACACTAAAGAAGAGTATTTCAACTCCTTTCATGAACACAGCTTCGAAGATGTATTCCATGTCTGAGGTGAGGAAGCACAACTCTTCAGACT
CTGCTTGGATCATAGTCCATGGACATATCTACGATGCCTCACGTTTCTTGAAAGACCATCCTGGTGGTGTTGACAGCATTCTCATCAATGCTGGA
ACTGATTGTACTGAGGAATTTGATGCAATTCATTCTGATAAGGCTAAGAAACTATTGGAGGACTTTAGGATTGGTGAACTCATAACTACTGGTTA
CACGTCTGATTCGTCTCCAAACACTTCTGTCCATGGGATCCTCTTNCATAGTAGCTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E410226] SGN-U271417 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T257301 [Download] [View] Facility Assigned ID: PPICJ75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5