EST details — SGN-E410249

Search information 
Request: 410249Match: SGN-E410249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C259233Clone name: PPI-16-B9
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E410249Length: 676 bp (945 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E410249 [] (trimmed) GTTTTATGGTTCAAAGGGTCCTACTTTTGGCACCAAAGTTAGCAACTACCCACCATGTCCCAAGCCTGATCTCATTAAAGGCCTGAGGGCTCACA
CAGATGCTGGTGGCATCATCCTTCTATTCCAAGATGACAAAGTCAGTGGTCTCCAACTACTCAAAGATGGCAAATGGATTGATGTTCCACCAATG
CGCCACTCCATTGTCATCAACCTCGGTGACCAACTCGAGGTGATTACCAATGGAAAATACAAGAGTGTGGAGCACAGGGTGATTGCTCAGCCTGA
TGGAAACAGAATGTCCTTGGCTTCGTTCTATAATCCGGGGAGTGATGCTGTCATCTATCCAGCACCAGAATTGTTGGAGAAGGAAGAAAAAGAGA
ACACAGTAATGTATCCCAAATTTGTTTTTGANGACTATATGAAATTATATGCAGGTCTCAAATTCCAAGCTAAGGAGCCAAGGTTTGAAGCAATG
AAGGCTGTGGAAACTGCTGTCAACTTGGGCCCAATAGCAACTGTTTGATGAGACCAGTCAGTATTAATACAACACTAATTAATGGGAAATGGAAT
GGGAAAGAAAGATTGTTTAGTACTAAGATAATGATNGTGTAATAATTTGTTAATGNTGGTTTTATTAGTGGGATGCTTTGTGCAACTTGGGTTTT
CTTTATGTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E410249] SGN-U269935 Solanum tuberosum Build 4 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T257324 [Download] [View] Facility Assigned ID: PPICK05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0187 Quality Trim Threshold: 12.5