EST details — SGN-E410357

Search information 
Request: 410357Match: SGN-E410357
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C259302Clone name: PPI-16-F10
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E410357Length: 589 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E410357 [] (trimmed) AGTTAATGGAAATATTTCTGGCCTAAAACCTGGACTTCATGGCTTCCATGTCCATGCCCTTGGTGATACCACAAATGGCTGCATGTCAACAGGAC
CACATTACAATCCTGCTGGTAAGGAGCATGGTGCTCCTGAAGATGAGGTGCGTCATGCTGGTGATCTTGGTAACATCACAGTTGGAGAAGATGGT
ACTGCATCTTTTACTATTACCGACAAGCAGATTCCTCTCACTGGTTCACAATCCATCATTGGAAGAGCTGTTGTTGTTCATGCTGATCCTGATGA
TCTTGGAAAGGGAGGACATGAGCTCAGTAAAAGCACTGGAAATGCTGGCGGAAGGATTGCTTGTGGTATTATTGGCCTCCAGGGTTAATTGCTCC
TGCGGGGTGAAGATTCAGCAACTAGCGGTGGTGGTCTTAGAATAAAGTTTTATTGGAGCGGCTGAGCCTTGTTTTCTATGTATTTATCATGCGAC
GCCTTTTGAATTTTCATAATACATGACTTCAGTGTATGTTGTACTAGTTTTTGCCGATCATTAACCATAAAAAAAAATGCGGGCCGTTAGCTTTG
CTGGTTTCTTAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E410357] SGN-U268852 Solanum tuberosum Build 4 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T257432 [Download] [View] Facility Assigned ID: PPICL29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5