EST details — SGN-E410655
Search information |
Request: 410655 | Match: SGN-E410655 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C259827 | Clone name: PPI-17-N5 |
| ||
Library Name: PPI | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6-week old leaf
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E410655 | Length: 196 bp (956 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E410655 [] (trimmed)
CAACATCAACAACCTACTAACCCACATCTTTAATTCATAATAATATTGTACTTTTCTTGTTTTCCCATTGTTTAATGCAATAATATTTTCTTCTA
ACAAATTAGAAGAAGGATTATCAGTGTTCTCACTTAGAGAGATACTTTATTTTCTTTCTATCGCATTAATTTTCAACATTTGAAAAAAAAAAAAA
AAAAAA
ACAAATTAGAAGAAGGATTATCAGTGTTCTCACTTAGAGAGATACTTTATTTTCTTTCTATCGCATTAATTTTCAACATTTGAAAAAAAAAAAAA
AAAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E410655] | SGN-U280385 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T257730 [Download] [View] | Facility Assigned ID: PPICO75TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.870 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |