EST details — SGN-E411034

Search information 
Request: 411034Match: SGN-E411034
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267437Clone name: STM-14-C7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C267437 [STM-14-C7] Trace: SGN-T263170 EST: SGN-E411033 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411034Length: 322 bp (906 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E411034 [] (trimmed) ATATACTCATTACTGGAGCTGCCGGATTTATTGCATGTCATGTAGCCAATAGGCTTGTTCGGAGCTACCCTGATTACAAGATTGTTGTCCTTGAC
AAACTTGACTATTGTTCAAATTTGAAGAACCTTATTCCTTCCCGATCTTCCCCTAATTTCAAGTTTGTTAAGGGAGATATTGCTAGTGCAGATCT
CGTTAACTACCTTCTCATAACTGAGTCCATTGACACTATAATGCACTTTGCTGCTCAGACCCATGTTGATAACTCCTTTGGTAATAGCTTTGACT
TCACTAAGAACAACATCTATGGTACCCATGTACTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411034] SGN-U269958 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263171 [Download] [View] Facility Assigned ID: STMCA16TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5