EST details — SGN-E411107

Search information 
Request: 411107Match: SGN-E411107
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267592Clone name: STM-14-K1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C267592 [STM-14-K1] Trace: SGN-T263243 EST: SGN-E411106 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411107Length: 293 bp (1003 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E411107 [] (trimmed) TTTTTTGAAAGAGAAGAAAATGTTGTGTTACTTTGACTTTGATTTTGATGTAAATTTGGTCAGTATTGGAACACCTAATTAAGTCAATAATAAAA
TGTAATGGAGATCTAAAAAACCAGAAAACAAAGACGAGACCACTATATTATGTGTTACTTTGAGCTAATTTATATACCTAAGTTTATCAAGGTAA
GAAAAAAGCAACTACAAAGGGCAGTGCAGAAAATTAAGTTTTAGCTTGGTTGGTGTTTGCTGAGGGAGATGATTGTTGGTTTTGTCCTTTGGGAG
GGATCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411107] SGN-U282159 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263244 [Download] [View] Facility Assigned ID: STMCA61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0009 Quality Trim Threshold: 20.5