EST details — SGN-E411331

Search information 
Request: 411331Match: SGN-E411331
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267461Clone name: STM-14-D9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C267461 [STM-14-D9] Trace: SGN-T263467 EST: SGN-E411330 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411331Length: 604 bp (940 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E411331 [] (trimmed) TTCTTCCCATTAAAACAATCTCATTCTAGTTTCATCCTAGTTTTTGTTTTGAATTTGTGAGTAATTTAATCGGTTTCGATTTTCATTCAAATTTG
TCTTCAATGGCTGCTGCTATGGGAATGATGGGAAGTATTGGGGGTTGTGGAGCAGCTTCTGCATCTCTGTTTCGATTGAGGAACTCAGCGAAGAA
GAAGACCAGAAACGATAACAATGGATTTAGGGTTTCATGTGTTTATTCATCTTCTGCTGTTGCCGATCCGTATAAGACCTTGAAGATTCAACCTG
GTGCATCTGAATCTGAAGTTAGAAAGGCCTTTAGACAGCTTGCTCTTAAGTATCACCCAGACGTATGCAGAGGAAACAATTGTGGTGTTCAATTT
CACCAAATCAATGAAGCTTACGATGTTGTGATGAGTAATTTGAGAGGTGAAACAAGAGCAGAGTTAGAGATGATTGAGGAATATGATGATAGTAA
TGATGAATCGATGAGAGGAATGTATGAACCACATTGGGATCTATGGGAAGAGTGGATGGGATGGGGAAGGTGCTGGCATTCCTGATTATACTTCT
CATGTTAATCCTTACATATGAATGGGGATTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411331] SGN-U273767 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263468 [Download] [View] Facility Assigned ID: STMCC17TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0180 Quality Trim Threshold: 14.5