EST details — SGN-E411366

Search information 
Request: 411366Match: SGN-E411366
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267544Clone name: STM-14-H5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411366Length: 551 bp (910 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E411366 [] (trimmed) AATTCCAAAACCAACAAAAGAGAGTAATTGTTGTTTTGAGTGTAAGTTAGCAATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCAC
TAAGATCTAGCCCTGCTAGAACATCATCTGTTCCATCCCCTAAGCCTAACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAACAACACC
AGCAACGCCGTCTCTCGCCGATTGGCTCTTACTCTCCTCATTGGTACTGCTGCCATTGGTTCCAAAGTTTCCCCTGCAGATGCTGCCTATGGAGA
AGCTGCAAATGTTTTTGGTAAGCCAAAGAAGTCCATCACCGACTACGGCTCCCCTGAAGAATTCCTCTCTAAAGTGGACTATCTGCTAGGAAAGC
AAGCTTACTTTGGTAAAACTGATTCAGAGGGTGGATTTGAATCTGGTGCAGTGGCAACTGCTAACCTGTTGGAGGCATCAAGCGCAACAGTGGGA
GGAAAACAGTACTACTACTTGTCAGTATTGACAAGAACTGCAGATGGAGATGAAGGTGGGAAGCACCAGTTGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411366] SGN-U269033 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263503 [Download] [View] Facility Assigned ID: STMCC39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5