EST details — SGN-E411448

Search information 
Request: 411448Match: SGN-E411448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267703Clone name: STM-14-P11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C267703 [STM-14-P11] Trace: SGN-T263586 EST: SGN-E411449 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411448Length: 314 bp (995 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E411448 [] (trimmed) CTTTCAAAGGGATGACAGCTGGATCACCATAAGGGTCAGGATAAACATCCATGTTTTTATTCTGACCCTTATGGTGATCCAGCAAAGTTCTTTCA
AAGGGATGACAGCTTCCAGAGAGATTTTTACCAAATTGCATTGCTGCTGGCAGTTATATATTTTGTCGTACAGTTCTTGAGGGCAACTTTATGAG
ACTCATAATTTTAAGTTGATATAACATTTGTATAATTGTAATTATTAAATTCATGTTTCTATATTGATACATATACATACTTTGGGGAATATATA
TCACTTCAAATTTTATTTAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411448] SGN-U281908 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263585 [Download] [View] Facility Assigned ID: STMCC90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.903 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5