EST details — SGN-E412218

Search information 
Request: 412218Match: SGN-E412218
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268009Clone name: STM-15-N16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268009 [STM-15-N16] Trace: SGN-T264356 EST: SGN-E412219 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412218Length: 584 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E412218 [] (trimmed) CCCAGTTCCACAGCAAAGCCGCCATGGAAGAAGCTGAAGAATTGAACCTGAAGAGCTTCCTGAAATGGGCAGTGGAGCTGGGAATCTCAGATTCT
CCTTCAACTTGTACAACCCAATCAGATTCATGTTTGGGAAACACCCTTTGTGTCTCTAATTTCCCTAAAGCCGGAGGGAGAGGTTTAGCAGCAGT
TCGTGATATTAAGAAAGGGGAATTGATTCTTAGAGTTCCAAAGGGAGCGTTAATGACTAGTCAAAATCTTATGATGAACGATGAGGCATTCTCCA
TTGCTGTCAAGAATCACCCTTCTCTGTGCTCCACACAGATATTGGCTGTTGGATTGTTAAATGAAGCGAACAAGGGTAAGAGTTCAAGGTGGTGG
CCCTATCTAAAACAGTTTCCCCGAAGCTATGACACACTTGCTGATTNTGGCAAATTCGAGATACAAGCATTGCAAATTGATGATGCCATATGGGC
TGCACAAAAGGCTTCTCGGAAGGCTGAAGAGGAGTGGAATGAAGTGACTCAGCTTATGCATGAACTGAAGCTCAAGCCACAATTCCTCGCTCTTA
AAGCATGGCTCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412218] SGN-U273508 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264355 [Download] [View] Facility Assigned ID: STMCH80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5