EST details — SGN-E412287

Search information 
Request: 412287Match: SGN-E412287
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268176Clone name: STM-16-E7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268176 [STM-16-E7] Trace: SGN-T264425 EST: SGN-E412288 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412287Length: 610 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E412287 [] (trimmed) GACTCCTGTCAATCTTAATTCGGATTCATTTAAAACTTATGTTCTTAGAGAACCTCTTGGTGTTGTGGGATTGATAACTCCATGGAATTATCCAT
TGTTAATGGCCATATGGAAAGTTGCCCCTGCTCTGGCTGCTGGTTGTGCAGCAATACTTAAGCCGTCTGAACTAGCATCAATTACCTGTTTGGAG
TTGGGTGAGATCTGTAGAGAGATTGGTCTTCCTTCTGGTGCCCTTAACATTTTAACAGGATTGGGGCCTGAAGCTGGTGGTCCTTTGGCATCTCA
TCCTCATGTGGACAAGATTTCATTTACAGGAAGTGGACCTACAGGATCTAAGATCATGACTGCTGCAGCTCAACTAGTTAAACCAGTTAGTCTTG
AGCTTGGTGGAAAAAGTCCAATAGTTGTGTTTGACGACATCGATAACCTTGATATAGCTGCTGAGTGGACTCTTTTTGGTATCTTTGCGAATACT
GGTCAAGTTTGTAGTGCAACATCACGGCTTATAGTACAGGAAAGCATTGGTTCTGCATTTTTGGACAGGCTGCTTAAGTGGACCAAAAACATCAA
AATCTCCGATCCTTTGGAAGAAGACTGCAAGCTTGGTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412287] SGN-U268975 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264424 [Download] [View] Facility Assigned ID: STMCI28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5