Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E412805

Search information 
Request: 412805Match: SGN-E412805
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268282Clone name: STM-16-J4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268282 [STM-16-J4] Trace: SGN-T264941 EST: SGN-E412804 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412805Length: 582 bp (931 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E412805 [] (trimmed) ATAACTTTTTTTTTTGAAGAGGAAAAGAACTGTATATAAATTATGCACTATGAACAGATTTTAGCGTCTCGTTTTGGTACAATGCACTCCAAGTC
TGCAAAACAACAGGCTCGAAGTCATTTCTCATGAATAGAAACAAAAACAAAAAAAAGACACCTCCACGTGTTAGAATAGGCAACATGCTGAGTAC
TCAACGTCACATGGAAACTATGGTTCATAGTCCGGGCCATCTGTTTCACCCCTTGAAGTACCCTGATCAGCACCAAATGTCCTCTTGCTCATGTT
TGCTCGTTGCACTAGCCGAACTAATGCTTCAACCACTTCCGACATAGGTGGCCTGAACTCGGGCTCAGGCTGGACACAGAGAGCTATTACATCAG
CAAAGCGTGATAGAGATTTAACAGGATAGAGCCCCTCGAGTGCTGGATCAACCATCTTAGCTAGGGCATCAATATCATGCAGCTGAGGTGTTGCC
CATCTAACTAGAGATTGTTCAGATCTTGTTCTTGCGCTATCAAAAGGTTTTCGTCCGGTAAGAAGTTCCAACATAACCACTCCAAAGCTGTACAC
ATCACTTTTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412805] SGN-U268912 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264942 [Download] [View] Facility Assigned ID: STMCL50TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5