EST details — SGN-E413314

Search information 
Request: 413314Match: SGN-E413314
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268756Clone name: STM-17-P5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268756 [STM-17-P5] Trace: SGN-T265450 EST: SGN-E413313 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413314Length: 497 bp (926 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E413314 [] (trimmed) GAGGATCATATGGTAAAATACAATAGAATGATTGCGGGTGCAATTCATATTTCCTAAACCTACAAACAATGTTTATTTATACAACTTGTGCAACA
AATGGGTCAAAAAGAAAGGATTTGATTTAGAATTCATAAATCATCAGCCGGCGGAATCTCACTCAAGTCCAGTCCATCCTCGGGTAGTTCAGAGG
TCAGCGGACCTAAAATCCCGTCAGAGTTGAGGGTCAATCCACTCTCAGGCTGGAACCTCAGCATATCTGCACGGGCCATGGCTTCAGCTTGGGCA
ATTCTCTGCCTGAATGTCTGAGCCATCTCTTCAGCCTTCTCAAAGACAAGCTTTGGATTGCGAATCATGTCACCAGGTGTAGGCTCTAGCTTCTT
TGTAGAAAGGCTCACTCGACCTCTCTCACGGTCATGGCTCAATATCATGACCTTGAGTGTGTCACCAGGCTGGAGGACTGTTGCAATATCTGAGA
CACGATCATGACTAATCTGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413314] SGN-U270777 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265451 [Download] [View] Facility Assigned ID: STMCO87TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0030 Quality Trim Threshold: 20.5