EST details — SGN-E413404

Search information 
Request: 413404Match: SGN-E413404
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268576Clone name: STM-17-H16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268576 [STM-17-H16] Trace: SGN-T265540 EST: SGN-E413403 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413404Length: 579 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E413404 [] (trimmed) CTGAAAATTACTTTTTCATTTAAAATTTAATTATATATTTTCCCTCATGTTGAAGACACAATTCGGTACAATCAGGGAAAGACTGCTTCTTGAGC
AACTTTCTTCCTTTTTTTCTTCCTTGATAGTGTCAATGTAGACTCTAAACTAATCAAATAAGTGATATATACTATCAGCCATAAAAACCTTGACA
CCAAGTTCATCTGAAAGTTCCCGAGCTTTCCTGTGTCACTTTAACATCAAAGGCCAAGATGGTTGCATACTCTTTCTTCTTCTCAAGCATAACAC
TAGCTTTAATGACATCCTTTTTATGCACAGGACCTATGCAAAATCCCACTGACATGTATGCTTACTTCCGGGGTCTTCAAAAATTCCAGCAAAGC
TTAGCTACAAAATCAAATAATCTATAGGAGACTTAAACATGACTATGAGTGGTCTAGAGTTAAAGAAATAACAAAATCTAAGAAAGTAATAGAAT
TATTCACATATGACTGATTGAACTAACAAAATAGACTGAAGGAGACTTCTCAGATGTTATACAGATGCTTACAACACCAAATGAGCTTTACTCAC
ATCTTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413404] SGN-U273136 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265541 [Download] [View] Facility Assigned ID: STMCP44TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0030 Quality Trim Threshold: 20.5