Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E413454

Search information 
Request: 413454Match: SGN-E413454
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268715Clone name: STM-17-N8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268715 [STM-17-N8] Trace: SGN-T265590 EST: SGN-E413453 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413454Length: 325 bp (911 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E413454 [] (trimmed) TTTTTGAAGGCGGAAAATGGCCGAACCATACATGAAATTGATTCAGTCATAACATAAGCTTACTTGCAACATAGATGACAGTCTACTGCATCTTT
TTCAAACTAGACAAACGAAATGTAACATGCACCAACTAAGGGGTGGGATTATTGAAAAAAACAGACGACCTCGACGACAAACTGGAGATGCTAAC
AAGACACTTCAAGCAGTTCAGTAGGACCAAATCTCATCTTCCTCTGTTGCACAATCCTGCAGCATTGTCTTCACTGTAATAGTAATAGCCACCAT
TATTGGCATTGGCATTGGCACTGGCAGTGGCAGTGGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413454] SGN-U269363 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265591 [Download] [View] Facility Assigned ID: STMCP76TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5