EST details — SGN-E413456

Search information 
Request: 413456Match: SGN-E413456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268698Clone name: STM-17-N10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268698 [STM-17-N10] Trace: SGN-T265592 EST: SGN-E413455 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413456Length: 480 bp (913 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E413456 [] (trimmed) ACATCTTATATGTTTAAAATAACAGTTTTCTCCCCTTACATAACAAATTTATAATACAAAAACATTAACATACAAGAAATTTAAATATTAAAGCA
TTAAATTTTAGCAAAATCTAGTGATGCTTTACCAGAAGGCCTCTTAATGTAGCAATGATCCCAATAATCAGAGAACAAAATATCTTTGTACACTG
GTTTTTCTCCATCTTTTAGCATTTGTGGGAATGAACCGATGACACTATCAAAACTAGGATTCACTATTAGCGGTACAGATATTCGAGTCCTGCTC
GAATCAACTGCTACACAATGCTCGATACTCTTGTATCGATCATTGCTCATGATCTGCAATGAGTCACCTATATTAACTGTTAAGGCACCTTTGAT
AGGATTTACGTGAATCCAGTTGTCTTTAGTCCCTCGGATATATAGGCCTCCCGTGTCGTCCTGGAGGAGCAAAATTATGCAGCCCATGTCGCAAT
GTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413456] SGN-U269496 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265593 [Download] [View] Facility Assigned ID: STMCP77TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0211 Quality Trim Threshold: 14.5