Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E413592

Search information 
Request: 413592Match: SGN-E413592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269003Clone name: STM-18-K7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269003 [STM-18-K7] Trace: SGN-T265728 EST: SGN-E413591 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413592Length: 489 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E413592 [] (trimmed) CGGGCCCCCCCTTACTCAGTGTCAAATTTGAAACAATTCATGTCAGGTTACTTATTCTCCAGTGTCACTATATACAAAATGCATCAGCTAGACTT
GGCGGACTAGTAAAGGAGTAAATTACTAATCATTCAATATTTTTGTGTGTGAAGAATTTCAGGAATCAGTAGTTGGATTGGGACATTGAAATAAG
ACGATGAACCAAGAAATGAGTGGTGTTGAGGATCAGAAGCAGCAAGATCAAATGAAACGTGTAAATGGGGTTCATCATAATGGAGGATAAAATAG
ATTATGTGTTTAAGGTGGTGGTGATTGGAGACTCTGCTGTTGGGAAAACTCAGGTTCTTTCCAGGTTTGCTAAGAATGAGTTCTGTTTTGACTCA
AAATCTACAATTGGTGTTGAGTTTCAGACTAGAACTGTTTCTATTCAGTCTAAAGTGATTAAGGCTCAGATCTGGGACACTGCTGGACAAGAAAG
ATACAGAGCAGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413592] SGN-U274161 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265729 [Download] [View] Facility Assigned ID: STMCQ64TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0083 Quality Trim Threshold: 20.5