EST details — SGN-E413623

Search information 
Request: 413623Match: SGN-E413623
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269042Clone name: STM-18-M21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269042 [STM-18-M21] Trace: SGN-T265761 EST: SGN-E413624 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413623Length: 692 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E413623 [] (trimmed) GCATATTGGACTTCTCTCTCTCTCTCTCTCTCTCTAAGCCATTCAAGGGTGACCTGAGATCACATACAAAAATGGTGAAGGCAGTCGCCGTCCTT
AACAGCAGTGAAGGTGTTAGTGGCACCATCCTCTTCACTCAAGATGGAGATGCTCCAACCACAGTTAATGGAAATATTTCTGGCCTAAAACCTGG
ACTTCATGGCTTCCATGTCCATGCCCTTGGTGATACCACAAATGGCTGCATGTCAACAGGACCACATTACAATCCTGCTGGTAAGGAGCATGGTG
CTCCTGAAGATGAGGTGCGTCATGCTGGTGATCTTGGTAACATCACAGTTGGAGAAGATGGTACTGCATCTTTTACTATTACCGACAAGCAGATT
CCTCTCACTGGTTCACAATCCATCATTGGAAGAGCTGTTGTTGTTCATGCTGATCCTGATGATCTTGGAAAGGGAGGACATGAGCTCAGTAAAAG
CACTGGAAATGCTGGCGGAAGGATTGCTTGTGGTATTATTGGTCTCCAGGGTTAATTGCTCCTGCGGNGTGAAGATTCAGCAACTAGCGGTGGTG
GTCTTAGAATAAAGTTTTATTGGAGCGGCTGAGCCTTGNTTTCTATGTATTTATCATGTGACGCCTTTTGAATTTTCATAATACATGACTTCAGT
GTATGCTGTACTAGTTTTTGCCGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413623] SGN-U268852 Solanum tuberosum Build 4 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265760 [Download] [View] Facility Assigned ID: STMCQ83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0103 Quality Trim Threshold: 12.5