EST details — SGN-E413922

Search information 
Request: 413922Match: SGN-E413922
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269012Clone name: STM-18-L15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269012 [STM-18-L15] Trace: SGN-T266060 EST: SGN-E413923 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413922Length: 369 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E413922 [] (trimmed) GTTTGCACAGAAAGCTATGGGAACAAAGGATGTCAGAGTGGATGTGAAGCTGAACAAGCAGATCTGGAGCAGGGGCATCCGAAGTGTTCCAAGAC
GTATCAGAGTTCGTATTGCTCGCAAGAGGAATGACGATGAGGACGCAAAGGAAGAGCTCTACTCTCTTGTCACTGTTGCAGAGATCCCAGCAGAG
GGTTTGAAGGGTCTTGGTACCAAGATCATCGAAGATGAGGAATAAACTGTCTTTTTTAGCGAAGAATGATGATACCATTAGTGTTTTTTGTTATC
CCTTTTAGTGCTTTGAGACTGCTAAATNNTGTTTATGATACTCAAGTATTTCCGTGTTTCAAAGTTCTCACCATGATTTTAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413922] SGN-U269271 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266059 [Download] [View] Facility Assigned ID: STMCS68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0158 Quality Trim Threshold: 12.5