Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E414184

Search information 
Request: 414184Match: SGN-E414184
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269300Clone name: STM-19-I7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414184Length: 673 bp (910 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E414184 [] (trimmed) ATAACTATTTTTCACAGTGTTAACCAGTCAAATCCTGTAGCTTGAAGCCTTGAACTGTTTCTGATCGGATTAAAACAAAAAAGATGATGCAACAC
ACATTGAATTGTGATAAAACTGGCCATTAACAAATATTTTTTGGCCACATAATTCGTTCTGATATACACTCCTATAGTTGCAGCTTAATATAATA
TACTTCGGCAGAAACAGCTACGCAGCTCTTTGACGATCGCATTAATATACACAAACTATATACCAAACAAGCAGATCCCCATATTAAACCGACAC
ACGCAAGTGCCTTTCACTACAAAACATAATCAAGGTAGTGGTGGTAATGTTTACGGTTGAACTCCAGCAAGCTACCATAGGTTCGGTCTGCCACT
CCAATAAAGAGAGCTTCAGTATCAGGACTGAAGGATATCCCAGCAATCTCACCAAACAAATCAATCTCTTGACAGGCACCATAATCAGATTGCGT
ATCGAATATGTGGACAAAATCAGCTGGCTCCGCAATGGCCATGAAGCGCCCATCTGATGTGAACTTGATTGCACGGATGGCTCCCATCCTTCCTT
TGAGCACTGCTATGGACTGCGAAGTGTTCCTTATATCCCATAATCTGCAAGTTGTGTCTTGGTTACCAGTTGCCAAAATTCTTCCCCTCGGATGC
CAAGCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414184] SGN-U276802 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266321 [Download] [View] Facility Assigned ID: STMCU52TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0133 Quality Trim Threshold: 14.5